udev does not create a device

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Ngày tải lên : 07/03/2014, 16:20

... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC ... 51SufI-BamHI-rv (5¢-ACGCGGATCCAG TCATAAACAGCGGTTGC-3¢, BamHI site underlined), 87SufI-BamHI-rv (5¢-ACGCGGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT ... Tat apparatus FEBS Lett 534, 156–160 Miller, J.H (1992) A short course in bacterial genetics: A laboratory manual and handbook for Escherichia coli and related bacteria Cold Spring Harbor Laboratory...

9
393
0

How to create a Raid Device using Madadm

Ngày tải lên : 19/09/2012, 09:21

... partitions of sda5,sda6,sda7 This is how we can create a Raid device with level ***RAID 1*** #mdadm create /dev/md0 level=1 raid-devices=2 /dev/sda{5,6} This is how we can create a Raid device ... distributed in all If one hard disk fails, data on that can be regenerated by the data and parity information in the other two hard disks ###RAID### Raid :need disks Raid :need disks Raid :need disks ... thus increasing the read performance But can be utilize only 50% of the total size Level 5: It is a combination of striping and parity Need at least three hard disks Both parity and data are distributed...

3
953
0

Why Copying LIS from a Developed Country Does Not Work for a Developing Country?

Ngày tải lên : 18/10/2013, 14:15

... that it is so in practice Accordingly developing countries may require a more complex approach to an LIS than the relatively simple use of the LIS in many developed countries SUMMARY (Vietnamese) ... Pharaohs to Geoinformatics FIG Working Week 2005 and GSDI-8 Cairo, Egypt April 16-21, 2005 ộ TS – Applied SIM and SDI Trung Tran and Don Grant TS9.6 Why Copying LIS from a Developed Country Does ... and social implications The LIS suitable for developing countries must be capable of providing a sound base for economic and environmental planning This is certainly the theory...

2
422
0

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Ngày tải lên : 23/03/2014, 05:22

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... no MAP band was observed (not shown) Gene and mRNA analyses of MAP1b, MAP2, Tau, and STOP The ﬁnding that apparently normal neurites are formed even when CAD cells lack MAP1b, MAP2, Tau, and...

14
416
0

Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx

Ngày tải lên : 18/06/2014, 19:20

... and was critical to study design and completion All authors have read and approved the final manuscript Author disclosure statement Nanhai G Chen, Qian Zhang, Yong A Yu, and Aladar A Szalay are ... novel cancer treatment modality that several phase I and II trials are already underway Oncolytic vaccinia virus (VACV) strains have been of particular interest due to several advantages VACV’s ... imaging does not alter oncolytic or replication capability of a novel vaccinia virus Dana Haddad1,2†, Nanhai G Chen3†, Qian Zhang3, Chun-Hao Chen2, Yong A Yu3, Lorena Gonzalez2, Susanne G Carpenter2,...

14
490
0

Báo cáo hóa học: "Short-term locomotor adaptation to a robotic ankle exoskeleton does not alter soleus Hoffmann reflex amplitude" doc

Ngày tải lên : 19/06/2014, 08:20

... induce an alteration of reflex responses during human walking, it would have considerable potential as an aid for gait rehabilitation in addition to reducing manual assistance from the therapists ... exoskeleton assistance during walking may occur in two phases, a quick adaptation that occurs in the first few hours or days and a much longer adaptation that continues for weeks [60-62] The two adaptation ... managed data collections, completed data analysis and drafted the manuscript CLL developed a custom-written program to control the timing of electrical stimuli, assisted with data analysis and...

8
348
0

báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot

Ngày tải lên : 19/06/2014, 22:20

... beta antibody alters CNS and plasma A beta clearance and decreases brain A beta burden in a mouse model of Alzheimer's disease Proc Natl Acad Sci U S A 2001, 98(15):8850-8855 Dodart JC, Bales ... experimental autoimmune encephalitis (EAE) and nasal vaccination with glatiramer acetate reportedly decrease amyloid plaques in APP transgenic mice [48] Another report by the same group shows that, ... indicate that there is the potential of exacerbation of cerebral-amyloid angiopathy (CAA) associated microhemmorhages in certain mouse strains following passive immunization with certain anti -A antibodies...

13
410
0

báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx

Ngày tải lên : 20/06/2014, 03:20

... and was critical to study design and completion All authors have read and approved the final manuscript Author disclosure statement Nanhai G Chen, Qian Zhang, Yong A Yu, and Aladar A Szalay are ... novel cancer treatment modality that several phase I and II trials are already underway Oncolytic vaccinia virus (VACV) strains have been of particular interest due to several advantages VACV’s ... imaging does not alter oncolytic or replication capability of a novel vaccinia virus Dana Haddad1,2†, Nanhai G Chen3†, Qian Zhang3, Chun-Hao Chen2, Yong A Yu3, Lorena Gonzalez2, Susanne G Carpenter2,...

14
393
0

báo cáo hóa học:" Sexual behaviour does not reflect HIV-1 prevalence differences: a comparison study of Zimbabwe and Tanzania" ppt

Ngày tải lên : 20/06/2014, 08:20

... Calverton, Maryland: Central Statistical Office and Macro International Inc; 2000 19 National Bureau of Statistics [Tanzania] and Macro International Inc: Tanzania Reproductive and Child Health ... 2005-06 Calverton, Maryland: Central Statistical Office and Macro International Inc; 2007 Page of 21 National Bureau of Statistics [Tanzania] and ORC Macro: Tanzania Demographic and Health Survey ... paediatric AIDS in Rwanda AIDS 1992, 6:1515-1520 38 Prazuck T, Tall F, Nacro B, Rochereau A, Traore A, Sanou T, Malkin JE, ApaireMarchais V, Masson D, Dublanchet A: HIV infection and severe malnutrition:...

9
449
0

Báo cáo khoa học: " Exposure to genistein does not adversely affect the reproductive system in adult male mice adapted to a soy-based commercial diet" potx

Ngày tải lên : 07/08/2014, 18:20

... PHGPx and GAPDH were 462 and 302 bp, respectively The relative absorbance of specific mRNA was normalized to the relative absorbance of GAPDH mRNA Statistical analysis Data were analyzed using SAS ... 10% and artificial illumination of a 12-hr light-dark cycle All animals received humane care as outline with “Guide for the care and use of animals” (Chungbuk National University Animal Care ... (MAD: time-average of absolute values of the instantaneous turning angle of the sperm head along its curvilinear trajectory), lateral head displacement (ALH: displacement of the centroid from a...

8
343
0

Báo cáo khoa học: "A pre-operative elevated neutrophil: lymphocyte ratio does not predict survival from oesophageal cancer resection" pps

Ngày tải lên : 09/08/2014, 03:21

... local database for oesophageal cancer Demographic details, pre-operative staging data, operation type, histopathological diagnosis, staging and survival were extracted from the database Pathological ... would be assessed against standard clinical and histopathological data Page of 10 Table Demographics and preoperative haematology results from patients with resected oesophageal cancer Demographics ... vascular and cardiovascular diseases [17,18] All patients undergoing oesophagectomy have preoperative full blood counts taken routinely The NLR can be calculated easily from the data already available...

10
224
0

Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt

Ngày tải lên : 09/08/2014, 10:23

... Huntsville, AL USA) The primer sequences used were: for β-actin, forward CCTTCGTGCCCCCCC and reverse GGAGAC- CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and reverse GATCCACAGCAACTCCAGAA ... Taniguchi N, Kawahara K, Yone K, Hashiguchi T, Yamakuchi M, Goto M, Inoue K, Yamada S, Ijiri K, Matsunaga S, Nakajima T, Komiya S, Maruyama I: High mobility group box chromosomal protein plays a role ... immunohistochemical stainings and the immunohistochemical analysis JL performed the RT-PCR and mRNA analysis ES, CG, UA and HEH prepared the manuscript All authors read and approved the final manuscript Acknowledgements...

8
529
0

Báo cáo y học: "issed opportunities for participation in prevention of mother to child transmission programmes: Simplicity of nevirapine does not necessarily lead to optimal uptake, a qualitative stud?" pdf

Ngày tải lên : 10/08/2014, 05:20

... Providing a regimen that starts early in pregnancy should also be feasible as South Africa has an antenatal attendance rate of 90% and a mean number of ANC visits greater than three[10] Page of (page ... (Weliswa Binza, Vuyo Magasana, Pumza Mbenenge, Thantaswa Mbenenge, Thoko Ndaba, Nokuthula Radebe), the staff at the ARV clinics and all the respondents References Bradshaw D, Bourne D, Nannan N: What ... regions of South Africa with a poorly resourced health system and an antenatal HIV prevalence of 28%[12] Site C, is a periurban area with an antenatal prevalence of 41% [12] and an moderately well...

5
426
0

Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

Ngày tải lên : 11/08/2014, 03:20

... 174:5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/NF- kappa B pathway in saturated ... Takeda K, Kaisho T, Akira S: Toll-like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi ... 13.5 60.0 Data Analysis Data were presented as mean ± SD of mean The effect of genotype (WT and TLR4 mutant) within the diet (LF and TF) was assessed with a 2-way analysis of variance (genotype ×...

7
272
0

Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx

Ngày tải lên : 11/08/2014, 06:22

... 174:5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/NF- kappa B pathway in saturated ... Takeda K, Kaisho T, Akira S: Toll-like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi ... 13.5 60.0 Data Analysis Data were presented as mean ± SD of mean The effect of genotype (WT and TLR4 mutant) within the diet (LF and TF) was assessed with a 2-way analysis of variance (genotype ×...

7
238
0

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

Ngày tải lên : 11/08/2014, 08:21

... Directed antigen delivery as a vaccine strategy for an intracellular bacterial pathogen Proc Natl Acad Sci USA 2006, 103:5102-5107 10 Roberts DM, Nanda A, Havenga MJ, Abbink P, Lynch DM, Ewald BA, ... immunizations Hematological values and liver chemistries were unremarkable at all time points These results demonstrated that oral inoculation of live attenuated Lmdd and i.v D-ala administration was ... in parentheses for each group All Lmdd-gag vaccinations were preceded by oral administration of saturated sodium bicarbonate D-ala (640 mg/kg) was co-administered intravenously before and after...

7
393
0

Báo cáo y học: " Ingestion of 10 grams of whey protein prior to a single bout of resistance exercise does not augment " doc

Ngày tải lên : 11/08/2014, 23:21

... protein (8.6 g EAAs) [10] and 10 g EAAs [26] maximally stimulated MPS, but that MPS was also increased even at whey protein doses of g (2.2 g EAAs) and 10 g (4.3 g EAAs) [10] and an EAA dose of g ... key regulator Maximal activation of Akt occurs through phosphorylation of Ser473 and it appears that Akt may have a relatively short period of activation after an acute bout of resistance exercise ... participants had their body mass measured according to standard procedures using a self-calibrating digital scale (HealthO-Meter, Bridgeview, IL, USA) with an accuracy of ± 0.02 kg Participants...

9
193
0

Báo cáo khoa học: "nti-L-selectin antibody therapy does not worsen the postseptic course in a baboon model" pps

Ngày tải lên : 12/08/2014, 23:20

... to measure alanine aminotransferase, creatinine, and total protein (Roche, Basel, Switzerland) or lactate (Boehringer Mannheim, Mannheim, Germany) A Cobas Fara centrifugal analyzer (Roche, Basel, ... immunosorbent assay (ELISA) method IL-6 was determined using an immunoassay on microplates In this assay, a mouse monoclonal antihuman IL-6 antibody (5E1) was used for coating and a rabbit polyclonal antihuman ... and arterial pCO2, are summarized in Table The only significant cardiovascular difference was found in mean arterial pressure at 32 h, but was not reflected in cardiac output and SVR Cardiovascular...

10
361
0

Báo cáo y học: "Generation of a single pulmonary pressure-volume curve does not durably affect oxygenation in patients with acute respiratory distress syndrome" docx

Ngày tải lên : 12/08/2014, 23:23

... not significantly and durably affect oxygenation and haemodynamic parameters in ARDS patients 13 14 Matamis D, Lemaire F, Harf A, Brun-Buisson C, Ansquer JC, Atlan G: Total respiratory pressure-volume ... of ideal body weight) with a mean inspiratory:expiratory ratio of 1:1.9 All patients had stable haemodynamic parameters (mean arterial pressure [MAP] 76 ± 17 mmHg, heart rate 110 ± 17 beats/ minute) ... Variables were expressed as mean ± standard deviation A two-way analysis of variance (ANOVA) for repeated measures was conducted to study the effects of time and PV measurement on recorded parameters...

5
314
0

Báo cáo y học: "Tracheotomy does not affect reducing sedation requirements of patients in intensive care – a retrospective study" potx

Ngày tải lên : 12/08/2014, 23:24

... in dosage (Figure 2) From day -7 to day -1, morphine dosage Table Basic data on sedation dose Parameter days before tracheotomy days after tracheotomy days before tracheotomy days after tracheotomy ... sedatives Data are expressed as mean DD/ sedatives MDD When comparing the summed data of seven days before and after tracheotomy there was a significant difference in dosage and percentage of patients ... signed-rank test for continuous data and the McNemar test for categorical data Repeated-measurements analysis of variance was used to study changes over time in subjects, taking into account the association...

8
306
0